Protein Synthesis: Decoding DNA



G G T C T A C A C C T G T T G G G T C A C C T G A A A A T A T A A G T G C A T C G A C C


Comments

  1. Rodrigo,

    I'll provide you with a decode so you can respond for the final part of your assignment.

    I didn't see any errors in your coding process. Well done! Please let me know if I came up with the right sentence. Here is my decode:

    DNA: GGTCTACACCTGTTGGGTCACCTGAAAATATAAGTGCATCGACC
    RNA: CCAGAUGUGGACAACCCAGUGGACUUUUAUAUUCACGUAGCUGG
    Codons: AUG UGG ACA ACC CAG UGG ACU UUU AUA UUC ACG UAG
    (start) The skull monster ate the pizza in time for school. (stop)

    ReplyDelete
  2. The skull monster ate the pizza in time for school
    Sorry Rodrigo for being late on you.

    ReplyDelete

Post a Comment

Popular posts from this blog

Historical Influences on Darwin

Human Variation & Race

Homology vs Analogy